version
PlantPromoterDB promoter information of AT4G22850.1

Summary of Gene (AT4G22850.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G22850  TAIR      NCBI 
Gene model AT4G22850.1  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G12000.1); Has 1331 Blast hits to 1328 proteins in 349 species: Archae - 4; Bacteria - 600; Metazoa - 103; Fungi - 64; Plants - 162; Viruses - 0; Other Eukaryotes - 398 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 11993194-11994393)

Genome position     
from initiation codon
AT4G22850.2         
TSS from cDNA
TSS information
AT4G22850.1                      5'->3' (+)
Promoter sequence








 
AT4G22840.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G22850.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4+11994062-132

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+11994043-151

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTTTCTTTCCT+1199404411994059-150-135
Y PatchTTCTTCTT+1199409511994102-99-92
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGGACCC+1199377911993786-415-408
 AtREG596TGGGACCC PPDB MotifGGGACCC  PLACE Motif 
REGAACCCGACCCGACCC+1199381611993830-378-364
 AtREG580AACCCGAC        PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG405 ACCCGACCCGACC  PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG442  CCCGACCCGACCC PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG375   CCGACCCG     PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG383    CGACCCGA    PPDB Motif  PLACE Motif 
 AtREG390     GACCCGAC   PPDB MotifCCGAC, GGGACCC  PLACE MotifCCGAC 
REGATGGCCCA+1199385411993861-340-333
 AtREG437ATGGCCCA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTGGGCTTTAA+1199386311993872-331-322
 AtREG376TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365 GGGCTTTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG545  GGCTTTAA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone-11993770AT4G22840.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCCCTCTTTCTTC-1199375111993767AT4G22840.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGGTCGGGTC-1199382111993830AT4G22840.1
 AtREG442GGGTCGGG   PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG405 GGTCGGGT  PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG390  GTCGGGTC PPDB MotifCCGAC, GGGACCC  PLACE MotifCCGAC 
REGTGGGCCAT-1199385411993861AT4G22840.1
 AtREG437TGGGCCAT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTTAAAGCCCA-1199386311993872AT4G22840.1
 AtREG545TTAAAGCC   PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC  PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA PPDB MotifGCCCA  PLACE MotifTGGGCY 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.