version
PlantPromoterDB promoter information of AT4G24840.1

Summary of Gene (AT4G24840.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G24840  TAIR      NCBI 
Gene model AT4G24840.1  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport, Golgi organization; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: COG complex component, COG2 (InterPro:IPR009316); Has 214 Blast hits to 204 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 56; Plants - 22; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 12801926-12800727)

Genome position     
from initiation codon
AT4G24860.1         
TSS from cDNA
TSS information
AT4G24840.1                      5'->3' (-)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G24840.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-12800979-53

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCATCTCTC-1280100512801012-79-86
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCGGTTTGG-1280105512801064-129-138
 AtREG521TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496 CCGGTTTG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550  CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTGACTTT-1280109912801106-173-180
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 
REGTTTTGGGC-1280115512801162-229-236
 AtREG529TTTTGGGC PPDB MotifGCCCA  PLACE Motif 
REGTAAGGGGT-1280118412801191-258-265
 AtREG636TAAGGGGT PPDB MotifACCCCT  PLACE Motif 
REGCGGTTAAG-1280122612801233-300-307
 AtREG605CGGTTAAG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGTTGACTTT-1280124012801247-314-321
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 
REGCCGAACCA-1280127312801280-347-354
 AtREG655CCGAACCA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.