PlantPromoterDB promoter information of AT4G25080

Summary of Gene (AT4G25080)

Organism	Arabidopsis thaliana
Chromosome	4
Locus	AT4G25080 TAIR NCBI
Gene model	AT4G25080
Description	Encodes a protein with methyltransferase activity responsible for the methylation of magnesium protoporphyrin IX. Mutants defective in this gene are affected in chlorophyll biosynthesis and show a reduction in the accumulation of a number of major thylakoid-associated proteins including components of PSI (LHCI), PSII (LHCII, D1, CP43) and the cytochrome b6f complex (Cytf). By contrast, no significant changes were detected for the proteins of the stroma and the chloroplast envelope.

#

Overview

Focused view (chromosome 4: 12876015-12877214)

`Genome position from initiation codon` AT4G25070.1 AT4G25070.2 AT4G25080.1 AT4G25080.2 AT4G25080.3 AT4G25080.4 TSS from cDNA TSS information AT4G25080 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G25080

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak G 38 + 12876964 -51

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`G`	38	+	12876964	-51

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone T clone + 12876934 -81

TSS clone C clone + 12876948 -67

TSS clone T clone + 12876949 -66

TSS clone C clone + 12876950 -65

TSS clone C clone + 12876954 -61

TSS clone T clone + 12876955 -60

TSS clone C clone + 12876957 -58

TSS clone A clone + 12876959 -56

TSS clone C clone + 12876965 -50

TSS clone G clone + 12876966 -49

TSS clone A clone + 12876969 -46

TSS clone T clone + 12876989 -26

TSS clone A clone + 12877015 0

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`T`	clone	+	12876934	-81
TSS clone	`C`	clone	+	12876948	-67
TSS clone	`T`	clone	+	12876949	-66
TSS clone	`C`	clone	+	12876950	-65
TSS clone	`C`	clone	+	12876954	-61
TSS clone	`T`	clone	+	12876955	-60
TSS clone	`C`	clone	+	12876957	-58
TSS clone	`A`	clone	+	12876959	-56
TSS clone	`C`	clone	+	12876965	-50
TSS clone	`G`	clone	+	12876966	-49
TSS clone	`A`	clone	+	12876969	-46
TSS clone	`T`	clone	+	12876989	-26
TSS clone	`A`	clone	+	12877015	0

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CTCTCTCTCTC + 12876942 12876952 -73 -63

Y Patch CTTTCTCCTCT + 12876995 12877005 -20 -10

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CTCTCTCTCTC`	+	12876942	12876952	-73	-63
Y Patch	`CTTTCTCCTCT`	+	12876995	12877005	-20	-10
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG TGGGTCCCA + 12876874 12876882 -141 -133

AtREG615 TGGGTCCC ABA PPDB Motif GGGACCC PLACE Motif

AtREG596 GGGTCCCA PPDB Motif GGGACCC PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`TGGGTCCCA`		+	12876874	12876882	-141	-133
	AtREG615	`TGGGTCCC`	ABA	PPDB Motif	`GGGACCC`	PLACE Motif
	AtREG596	`GGGTCCCA`		PPDB Motif	`GGGACCC`	PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None