version
PlantPromoterDB promoter information of AT4G25580.1

Summary of Gene (AT4G25580.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G25580  TAIR      NCBI 
Gene model AT4G25580.1  
Description stress-responsive protein-related; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CAP160 (InterPro:IPR012418); BEST Arabidopsis thaliana protein match is: LTI65 (LOW-TEMPERATURE-INDUCED 65) (TAIR:AT5G52300.2); Has 231 Blast hits to 195 proteins in 64 species: Archae - 0; Bacteria - 20; Metazoa - 63; Fungi - 26; Plants - 81; Viruses - 6; Other Eukaryotes - 35 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 13055320-13056519)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G25580.1                      5'->3' (+)
Promoter sequence








 
AT4G25570.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G25580.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+13056184-136
TSS clone peakAclone+13056192-128
TSS clone peakCclone+13056263-57
TSS cloneGclone+13056265-55
TSS cloneAclone+13056271-49

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTGTATAAAAC+1305622813056237-92-83
Y PatchCGTCTTCCTCCTCTTTC+1305619513056211-125-109
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGTCGTTTT+1305595513055963-365-357
 AtREG569TGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG520 GTCGTTTT PPDB Motif  PLACE Motif 
REGAAACGGCA+1305600513056012-315-308
 AtREG500AAACGGCA PPDB MotifAAACG(C/G)  PLACE Motif 
REGGAATGGGCTAGTGGGCTAA+1305602113056039-299-281
 AtREG643GAATGGGC            PPDB MotifGCCCA  PLACE Motif 
 AtREG372 AATGGGCT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581  ATGGGCTA          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG532        TAGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG510         AGTGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG571           TGGGCTAA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTACGTGGCATGACACGTGGT+1305612113056140-199-180
 AtREG413TACGTGGC             PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG379 ACGTGGCA           ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG448  CGTGGCAT          ABA, DREB1Aox PPDB Motif  PLACE MotifGCCAC 
 AtREG438        ATGACACG    ABA PPDB Motif  PLACE Motif 
 AtREG389         TGACACGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG366          GACACGTG  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG382           ACACGTGG ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG544            CACGTGGTABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG21-13055618AT4G25570.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-13055623AT4G25570.1
TSS cloneAclone-13055622AT4G25570.1
TSS cloneTclone-13055621AT4G25570.1
TSS cloneTclone-13055620AT4G25570.1
TSS cloneGclone-13055618AT4G25570.1
TSS cloneTclone-13055617AT4G25570.1
TSS cloneTclone-13055615AT4G25570.1
TSS cloneAclone-13055584AT4G25570.1
TSS cloneGclone-13055566AT4G25570.1
TSS cloneAclone-13055544AT4G25570.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAGGGCCCACA-1305566313055672AT4G25570.1
 AtREG400AGGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG612  GGCCCACADREB1Aox PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTGAGGCCCACGTGTCT-1305568013055695AT4G25570.1
 AtREG587TGAGGCCC         PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG447 GAGGCCCA        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG482  AGGCCCAC       PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG464     CCCACGTG   ABA, Auxin, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG382      CCACGTGT  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG366       CACGTGTC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG470        ACGTGTCTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
REGGTCGTTTA-1305575113055758AT4G25570.1
 AtREG565GTCGTTTA PPDB Motif  PLACE Motif 
REGATCCACGTGGCGA-1305576613055778AT4G25570.1
 AtREG547ATCCACGT     ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG408 TCCACGTG    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG367   CACGTGGC  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG371    ACGTGGCG ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG471     CGTGGCGAABA PPDB Motif  PLACE MotifGCCAC 
REGCGGTTTAA-1305585013055857AT4G25570.1
 AtREG473CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGATAATGGGCCTTAA-1305588113055894AT4G25570.1
 AtREG546ATAATGGG       PPDB Motif  PLACE Motif 
 AtREG357 TAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG361  AATGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   ATGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353    TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG351     GGGCCTTA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG416      GGCCTTAA PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.