version
PlantPromoterDB promoter information of AT4G28520.4

Summary of Gene (AT4G28520.4)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G28520  TAIR      NCBI 
Gene model AT4G28520.4  
Description Encodes a 12S seed storage protein that is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds.  
#
#

Overview

Focused view (chromosome 4: 14086596-14087795)

Genome position     
from initiation codon
AT4G28520.1         
AT4G28520.2         
AT4G28520.3         
TSS from cDNA
TSS information
AT4G28520.4                      5'->3' (+)
Promoter sequence






 
AT4G28510.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G28520.4

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+14087567-29
TSS cloneTclone+14087568-28
TSS cloneCclone+14087569-27
TSS cloneCclone+14087570-26
TSS cloneAclone+14087571-25
TSS clone peakTclone+14087572-24
TSS clone peakTclone+14087574-22
TSS cloneAclone+14087578-18
TSS cloneCclone+14087579-17

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxATATATAAACT+1408753414087544-62-52
Y PatchCTCCTCCT+1408754314087550-53-46
Y PatchTTCTCTTC+1408755914087566-37-30
Y PatchCATCTCTC+1408757014087577-26-19
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGACGTGT+1408745614087464-140-132
 AtREG466GTGACGTG ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG517 TGACGTGTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGCTACGTGGCT+1408750214087511-94-85
 AtREG495CTACGTGG   PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG413 TACGTGGC  PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG450  ACGTGGCTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG2-14086868AT4G28510.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneCclone-14086812AT4G28510.1
TSS cloneTclone-14086791AT4G28510.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAAGCCCATCA-1408691514086925AT4G28510.1
 AtREG376AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG635   GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGCTAAGCCCAATAA-1408694514086957AT4G28510.1
 AtREG634CTAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG426 TAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402   AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355    GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG417     CCCAATAA PPDB MotifGCCCA  PLACE Motif 
REGATGGGCTTAT-1408696314086972AT4G28510.1
 AtREG378ATGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426 TGGGCTTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG462  GGGCTTAT PPDB MotifGCCCA  PLACE Motif 
REGGTTCGGTT-1408701914087026AT4G28510.1
 AtREG556GTTCGGTT PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.