version
PlantPromoterDB promoter information of AT4G29480.1

Summary of Gene (AT4G29480.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G29480  TAIR      NCBI 
Gene model AT4G29480.1  
Description mitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT2G19680.2); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 14488257-14487058)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G29480.1                      5'->3' (-)
Promoter sequence




 
AT4G29490.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G29480.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA31-14487729-472

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-14487743-486
TSS cloneGclone-14487740-483
TSS cloneTclone-14487739-482
TSS cloneTclone-14487735-478
TSS cloneGclone-14487728-471
TSS cloneAclone-14487718-461
TSS cloneAclone-14487712-455
TSS cloneAclone-14487707-450
TSS cloneTclone-14487702-445

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCATCTCTC-1448769714487704-440-447
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAAACGACATCG-1448780314487814-546-557
 AtREG576GAAACGAC     PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA    PPDB Motif  PLACE Motif 
 AtREG630    CGACATCG PPDB Motif  PLACE Motif 
REGACGACGTCGTT-1448782914487839-572-582
 AtREG431ACGACGTCGT  PPDB MotifACGT  PLACE MotifACGT 
 AtREG493   ACGTCGTT PPDB MotifACGT  PLACE MotifACGT 
REGCAAAACGCTGTCGTTTT-1448786714487883-610-626
 AtREG585CAAAACGC          PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
 AtREG626  AAACGCTG        PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG569        TGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG520         GTCGTTTT PPDB Motif  PLACE Motif 
REGATAAAGCC-1448789114487898-634-641
 AtREG601ATAAAGCC PPDB Motif  PLACE Motif 
REGGGCCTAAT-1448790014487907-643-650
 AtREG506GGCCTAAT PPDB Motif  PLACE Motif 
REGTTTCCGGTTA-1448799014487999-733-742
 AtREG644TTTCCGGT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 TTCCGGTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG621  TCCGGTTA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+14487900AT4G29490.1
TSS clone peakAclone+14487929AT4G29490.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCC+1448795514487962AT4G29490.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGATGTCGTTTC+1448780314487814AT4G29490.1
 AtREG630CGATGTCG     PPDB Motif  PLACE Motif 
 AtREG569   TGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG576    GTCGTTTC PPDB Motif  PLACE Motif 
REGAACGACGTCGT+1448782914487839AT4G29490.1
 AtREG493AACGACGT    PPDB MotifACGT  PLACE MotifACGT 
 AtREG431 ACGACGTCGT PPDB MotifACGT  PLACE MotifACGT 
REGAAAACGACAGCGTTTTG+1448786714487883AT4G29490.1
 AtREG520AAAACGAC          PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA         PPDB Motif  PLACE Motif 
 AtREG626       CAGCGTTT   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG585         GCGTTTTG PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.