PlantPromoterDB promoter information of AT4G30530

Summary of Gene (AT4G30530)

Organism	Arabidopsis thaliana
Chromosome	4
Locus	AT4G30530 TAIR NCBI
Gene model	AT4G30530
Description	defense-related protein, putative; FUNCTIONS IN: catalytic activity; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glutamine amidotransferase class-I, C-terminal (InterPro:IPR000991), Glutamine amidotransferase type 1 (InterPro:IPR017926); BEST Arabidopsis thaliana protein match is: defense-related protein, putative (TAIR:AT2G23960.1); Has 4359 Blast hits to 4359 proteins in 762 species: Archae - 195; Bacteria - 1510; Metazoa - 4; Fungi - 141; Plants - 56; Viruses - 3; Other Eukaryotes - 2450 (source: NCBI BLink).

#

Overview

Focused view (chromosome 4: 14904355-14905554)

`Genome position from initiation codon` `AT4G30500.1 TSS from cDNA TSS information AT4G30530 5'->3' (+) Promoter sequence AT4G30510.1 TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G30530

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 23 + 14920534 -71

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	23	+	14920534	-71

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone + 14920534 -71

TSS clone C clone + 14920535 -70

TSS clone T clone + 14920578 -27

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	+	14920534	-71
TSS clone	`C`	clone	+	14920535	-70
TSS clone	`T`	clone	+	14920578	-27

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box CATATAAATA + 14920498 14920507 -107 -98

Y Patch TCTCTCTCCT + 14920551 14920560 -54 -45

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`CATATAAATA`	+	14920498	14920507	-107	-98
Y Patch	`TCTCTCTCCT`	+	14920551	14920560	-54	-45
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG ACGTGGAA + 14920451 14920458 -154 -147

AtREG627 ACGTGGAA PPDB Motif ACGT PLACE Motif ACGT, ACGTG

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`ACGTGGAA`		+	14920451	14920458	-154	-147
	AtREG627	`ACGTGGAA`		PPDB Motif	`ACGT`	PLACE Motif	`ACGT, ACGTG`

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None