version
PlantPromoterDB promoter information of AT4G30580.1

Summary of Gene (AT4G30580.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G30580  TAIR      NCBI 
Gene model AT4G30580.1  
Description Encodes a plastidic lysophosphatidic acid acyltransferase (LPAAT). Is critical for chloroplasts phosphatidic acid biosynthesis. The null allele is embryo lethal.  
#
#

Overview

Focused view (chromosome 4: 14935489-14934290)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G30580.1                      5'->3' (-)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G30580.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-14934547-58
TSS clone peakGclone-14934527-38
TSS cloneCclone-14934519-30
TSS cloneCclone-14934518-29

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAACGACAC-1493460614934615-117-126
 AtREG520AAAACGAC   PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA  PPDB Motif  PLACE Motif 
 AtREG527  AACGACACDREB1Aox PPDB Motif  PLACE Motif 
REGAAAACGGCA-1493466614934674-177-185
 AtREG531AAAACGGC  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG500 AAACGGCA PPDB MotifAAACG(C/G)  PLACE Motif 
REGCAAAGGCC-1493470514934712-216-223
 AtREG656CAAAGGCC PPDB Motif  PLACE Motif 
REGAAATGGGCCAT-1493472614934736-237-247
 AtREG386AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG361 AATGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490  ATGGGCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG437   TGGGCCAT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGATAATGGG-1493475814934765-269-276
 AtREG546ATAATGGG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.