version
PlantPromoterDB promoter information of AT4G31120.1

Summary of Gene (AT4G31120.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G31120  TAIR      NCBI 
Gene model AT4G31120.1  
Description Involved in vernalization. Required for epigenetic silencing of FLC, and for vernalization-mediated histone modification.  
#
#

Overview

Focused view (chromosome 4: 15137568-15136369)

Genome position     
from initiation codon
AT4G31120.2         
AT4G31130.1         
TSS from cDNA
TSS information
AT4G31120.1                      5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G31120.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8-15136638-70

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-15136639-71
TSS cloneAclone-15136618-50

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATAAAGCCCATTAGAAAAGCCC-1513670515136726-137-158
 AtREG601ATAAAGCC               PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC              PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372    AGCCCATT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357     GCCCATTA          PPDB MotifGCCCA  PLACE Motif 
 AtREG558      CCCATTAG         PPDB MotifGCCCA  PLACE Motif 
 AtREG409              AAAAGCCC PPDB MotifGCCCA  PLACE Motif 
REGTAAATGGGCTA-1513674015136750-172-182
 AtREG443TAAATGGG    PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581   ATGGGCTA PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.