version
PlantPromoterDB promoter information of AT4G32272.1

Summary of Gene (AT4G32272.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G32272  TAIR      NCBI 
Gene model AT4G32272.1  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter-related (TAIR:AT4G31600.1); Has 1302 Blast hits to 1300 proteins in 174 species: Archae - 0; Bacteria - 4; Metazoa - 376; Fungi - 239; Plants - 567; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 15580689-15579490)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G32272.1                      5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G32272.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-15579881-192

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCCTCT-1557991215579919-223-230
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAACACGTGACA-1557992015579930-231-241
 AtREG590AACACGTG   ABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG628 ACACGTGA  DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG583  CACGTGAC  PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG606   ACGTGACAABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGTGTGGGCCTTG-1557994615579956-257-267
 AtREG612TGTGGGCC   DREB1Aox PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG482 GTGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353  TGGGCCTT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG398   GGGCCTTG PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTAAATGGGCTTA-1557996315579974-274-285
 AtREG443TAAATGGG     PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426    TGGGCTTA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTTAGCCCAAAC-1557997715579987-288-298
 AtREG571TTAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469  AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG474   GCCCAAAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.