version
PlantPromoterDB promoter information of AT4G32915.1

Summary of Gene (AT4G32915.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G32915  TAIR      NCBI 
Gene model AT4G32915.1  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: regulation of translational fidelity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glu-tRNAGln amidotransferase, C subunit (InterPro:IPR003837); Has 1227 Blast hits to 1227 proteins in 425 species: Archae - 17; Bacteria - 884; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 309 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 15884549-15885748)

Genome position     
from initiation codon
AT4G32910.1         
TSS from cDNA
TSS information
AT4G32915.1                      5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G32915.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8+15885524-25

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+15885521-28
TSS cloneGclone+15885527-22
TSS cloneAclone+15885534-15

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACCGGTTAAAACCGGTTTAG+1588542215885442-127-107
 AtREG552GACCGGTT              PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG503 ACCGGTTA             PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501  CCGGTTAA            PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG645   CGGTTAAA           PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG542        AAAACCGG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436         AAACCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412            CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG511             CGGTTTAG PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAAACGACAC+1588545615885465-93-84
 AtREG520AAAACGAC   PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA  PPDB Motif  PLACE Motif 
 AtREG527  AACGACACDREB1Aox PPDB Motif  PLACE Motif 
REGGTGTCGTTTT+1588547115885480-78-69
 AtREG527GTGTCGTT  DREB1Aox PPDB Motif  PLACE Motif 
 AtREG569 TGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG520  GTCGTTTT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.