PlantPromoterDB promoter information of AT4G33020.1
Summary of Gene (AT4G33020.1)
|
Overview
|
Focused view (chromosome 4: 15935267-15934068)
|
Genome position
from initiation codon TSS from cDNA TSS information AT4G33020.1 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT4G33020.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | None | None | None | ||||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | ATTTGGGCCAACCGGCCCAGTA | + | 15935203 | 15935224 | AT4G33030.1 | ||||
| AtREG421 | ATTTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG373 | TTTGGGCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG420 | TTGGGCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG484 | TGGGCCAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG457 | CCGGCCCA | CK | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | |||
| AtREG384 | GGCCCAGT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG434 | GCCCAGTA | PPDB Motif | GCCCA | PLACE Motif | |||||