PlantPromoterDB promoter information of AT4G33030.1
Summary of Gene (AT4G33030.1)
|
Overview
|
Focused view (chromosome 4: 15935051-15936250)
|
Genome position
from initiation codon TSS from cDNA TSS information AT4G33030.1 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT4G33030.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 4 | + | 15935459 | -592 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | C | clone | + | 15935446 | -605 |
| TSS clone | G | clone | + | 15935448 | -603 |
| TSS clone | A | clone | + | 15935450 | -601 |
| TSS clone | G | clone | + | 15935451 | -600 |
| TSS clone | G | clone | + | 15935459 | -592 |
| TSS clone | A | clone | + | 15935460 | -591 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CATCTCTCAT | + | 15935431 | 15935440 | -620 | -611 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | ATTTGGGCCAACCGGCCCAGTA | + | 15935203 | 15935224 | -848 | -827 | |||
| AtREG421 | ATTTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG373 | TTTGGGCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG420 | TTGGGCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG484 | TGGGCCAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG457 | CCGGCCCA | CK | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | |||
| AtREG384 | GGCCCAGT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG434 | GCCCAGTA | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | GGCCCACAAAGGCC | + | 15935271 | 15935284 | -780 | -767 | |||
| AtREG612 | GGCCCACA | DREB1Aox | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | |||
| AtREG656 | CAAAGGCC | PPDB Motif | PLACE Motif | ||||||
| REG | AACCGGAAA | + | 15935302 | 15935310 | -749 | -741 | |||
| AtREG534 | AACCGGAA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG644 | ACCGGAAA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| REG | TTTGGGCCATA | + | 15935352 | 15935362 | -699 | -689 | |||
| AtREG373 | TTTGGGCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG420 | TTGGGCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG437 | TGGGCCAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG479 | GGGCCATA | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||