PlantPromoterDB promoter information of AT4G33050

Summary of Gene (AT4G33050)

Organism	Arabidopsis thaliana
Chromosome	4
Locus	AT4G33050 TAIR NCBI
Gene model	AT4G33050
Description	embryo sac development arrest 39 (EDA39); FUNCTIONS IN: calmodulin binding; INVOLVED IN: polar nucleus fusion, response to chitin; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: calmodulin-binding family protein (TAIR:AT2G26190.1); Has 224 Blast hits to 148 proteins in 38 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 83; Plants - 134; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).

#

Overview

Focused view (chromosome 4: 15947736-15946537)

`Genome position from initiation codon` `AT4G33050.1 AT4G33050.2 AT4G33050.3 AT4G33050.4 TSS from cDNA TSS information AT4G33050 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G33050

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 2 - 15947009 -273

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	2	-	15947009	-273

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone - 15947026 -290

TSS clone A clone - 15947023 -287

TSS clone T clone - 15947022 -286

TSS clone T clone - 15947016 -280

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	-	15947026	-290
TSS clone	`A`	clone	-	15947023	-287
TSS clone	`T`	clone	-	15947022	-286
TSS clone	`T`	clone	-	15947016	-280

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG TACCCTTA - 15947058 15947065 -322 -329

AtREG570 TACCCTTA PPDB Motif ACCCT PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`TACCCTTA`		-	15947058	15947065	-322	-329
	AtREG570	`TACCCTTA`		PPDB Motif	`ACCCT`	PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None