version
PlantPromoterDB promoter information of AT4G33640.1

Summary of Gene (AT4G33640.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G33640  TAIR      NCBI 
Gene model AT4G33640.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 141 Blast hits to 141 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 16161211-16160012)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G33640.1                      5'->3' (-)
Promoter sequence





 
AT4G33650.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G33640.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA26-16160296-85

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-16160327-116
TSS cloneAclone-16160324-113
TSS cloneCclone-16160303-92
TSS cloneGclone-16160295-84
TSS cloneTclone-16160265-54
TSS cloneTclone-16160244-33

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTCTTC-1616027316160282-62-71
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAACCGGAT-1616033616160343-125-132
 AtREG561AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGCAAACCGGTTAAG-1616036516160377-154-166
 AtREG496CAAACCGG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436 AAACCGGT     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG503   ACCGGTTA   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501    CCGGTTAA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG605     CGGTTAAG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGCAAACCGGA-1616042816160436-217-225
 AtREG496CAAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 AAACCGGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTAAACCGG-1616046416160472-253-261
 AtREG519GTAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+16160954AT4G33650.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTCTCTTC+1616092616160938AT4G33650.1
Y PatchCCTTCTCTTCTTCC+1616097916160992AT4G33650.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.