version
PlantPromoterDB promoter information of AT4G34100.2

Summary of Gene (AT4G34100.2)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G34100  TAIR      NCBI 
Gene model AT4G34100.2  
Description protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G32670.1); Has 1572 Blast hits to 1390 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 796; Fungi - 185; Plants - 291; Viruses - 39; Other Eukaryotes - 261 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 16329590-16330789)

Genome position     
from initiation codon
AT4G34100.1         
TSS from cDNA
TSS information
AT4G34100.2                      5'->3' (+)
Promoter sequence






 
AT4G34090.1         
AT4G34090.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G34100.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA20+16330472-118

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGATGGGCTTAG+1633024716330258-343-332
 AtREG572AGATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG378  ATGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426   TGGGCTTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG634    GGGCTTAG PPDB MotifGCCCA  PLACE Motif 
REGTTAAGGCCCAAAC+1633027016330282-320-308
 AtREG416TTAAGGCC      PPDB Motif  PLACE Motif 
 AtREG351 TAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373    GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG474     GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGACCGGTTTAC+1633035916330368-231-222
 AtREG436ACCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG519  CGGTTTAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGGACCCGGTTAGGCC+1633037116330384-219-206
 AtREG463GACCCGGT       PPDB MotifAACCG(G/A), GGGACCC  PLACE Motif 
 AtREG455 ACCCGGTT      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG535      GTTAGGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-16330177AT4G34090.1, AT4G34090.2
TSS clone peakAclone-16330173AT4G34090.1, AT4G34090.2
TSS cloneTclone-16330161AT4G34090.1, AT4G34090.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCTAAGCCCATCT-1633024716330258AT4G34090.1, AT4G34090.2
 AtREG634CTAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG426 TAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG572    GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCCTTAA-1633027016330282AT4G34090.1, AT4G34090.2
 AtREG474GTTTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353   TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG351    GGGCCTTA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG416     GGCCTTAA PPDB Motif  PLACE Motif 
REGGTAAACCGGT-1633035916330368AT4G34090.1, AT4G34090.2
 AtREG519GTAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGT PPDB MotifAACCG(G/A)  PLACE Motif 
REGGGCCTAACCGGGTC-1633037116330384AT4G34090.1, AT4G34090.2
 AtREG535GGCCTAAC       PPDB Motif  PLACE Motif 
 AtREG455     AACCGGGT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG463      ACCGGGTC PPDB MotifAACCG(G/A), GGGACCC  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.