version
PlantPromoterDB promoter information of AT4G34290

Summary of Gene (AT4G34290)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G34290  TAIR      NCBI 
Gene model AT4G34290  
Description SWIB complex BAF60b domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWIB/MDM2 (InterPro:IPR003121); BEST Arabidopsis thaliana protein match is: SWIB complex BAF60b domain-containing protein (TAIR:AT2G14880.1); Has 806 Blast hits to 766 proteins in 168 species: Archae - 0; Bacteria - 129; Metazoa - 128; Fungi - 124; Plants - 206; Viruses - 9; Other Eukaryotes - 210 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 16406083-16407282)

Genome position     
from initiation codon
AT4G34280.1         
TSS from cDNA
TSS information
AT4G34290                        5'->3' (+)
Promoter sequence

 
AT4G34270.1         
AT4G34272.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G34290

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA23+16410835-48

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxACTATATAAGC+1641080016410810-83-73
Y PatchCGTCTTCT+1641084616410853-37-30
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAACGACGA+1641078616410793-97-90
 AtREG648AACGACGA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG4+16407082AT4G34280.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-16406206AT4G34270.1
TSS cloneAclone+16407017AT4G34280.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGCCGTTTT+1640686616406873AT4G34280.1
 AtREG531GCCGTTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGCCGGCCCA-1640625016406257AT4G34270.1
 AtREG457CCGGCCCACK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTTAAAGCCCATTAAG-1640630616406320AT4G34270.1
 AtREG545TTAAAGCC        PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC       PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA      PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372    AGCCCATT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357     GCCCATTA   PPDB MotifGCCCA  PLACE Motif 
 AtREG396      CCCATTAA  PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG604       CCATTAAG PPDB Motif  PLACE MotifTTAATGG 
REGAAAAGGCC-1640633316406340AT4G34270.1
 AtREG459AAAAGGCC PPDB Motif  PLACE Motif 
REGAGTGGGCT-1640649916406506AT4G34270.1
 AtREG510AGTGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.