version
PlantPromoterDB promoter information of AT4G34390.1

Summary of Gene (AT4G34390.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G34390  TAIR      NCBI 
Gene model AT4G34390.1  
Description extra-large GTP-binding protein 2 (XLG2); FUNCTIONS IN: guanyl nucleotide binding, signal transducer activity; INVOLVED IN: in 7 processes; LOCATED IN: nucleus; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Guanine nucleotide binding protein (G-protein), alpha subunit (InterPro:IPR001019), G protein alpha subunit, helical insertion (InterPro:IPR011025); BEST Arabidopsis thaliana protein match is: XLG1 (EXTRA-LARGE G-PROTEIN 1); guanyl nucleotide binding / signal transducer (TAIR:AT2G23460.1); Has 2643 Blast hits to 2642 proteins in 328 species: Archae - 0; Bacteria - 2; Metazoa - 1875; Fungi - 392; Plants - 229; Viruses - 0; Other Eukaryotes - 145 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 16437929-16439128)

Genome position     
from initiation codon
AT4G34380.1         
TSS from cDNA
TSS information
AT4G34390.1                      5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G34390.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+16441498-81

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTCACGCGCTT+1644141116441421-168-158
 AtREG631TTCACGCG   Drought PPDB Motif  PLACE Motif 
 AtREG395 TCACGCGC   PPDB MotifACGCGC  PLACE Motif 
 AtREG381  CACGCGCT  PPDB MotifACGCGC  PLACE Motif 
 AtREG492   ACGCGCTT PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+16438524AT4G34380.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxTGTATATATAAG+1643848816438499AT4G34380.1
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAAAGCCCAC+1643835016438359AT4G34380.1
 AtREG365TAAAGCCC   PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518  AAGCCCAC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGACCACGTGTGA+1643842616438436AT4G34380.1
 AtREG544ACCACGTG   ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG382 CCACGTGT  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG460  CACGTGTG ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG588   ACGTGTGAABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.