PlantPromoterDB promoter information of AT4G34620
Summary of Gene (AT4G34620)
|
Overview
|
Focused view (chromosome 4: 16537092-16535893)
|
Genome position
from initiation codon AT4G34630.1 TSS from cDNA TSS information AT4G34620 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT4G34620
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 26 | - | 16536121 | -29 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | A | clone | - | 16536153 | -61 |
| TSS clone | A | clone | - | 16536146 | -54 |
| TSS clone | C | clone | - | 16536145 | -53 |
| TSS clone | T | clone | - | 16536143 | -51 |
| TSS clone | T | clone | - | 16536126 | -34 |
| TSS clone | A | clone | - | 16536121 | -29 |
| TSS clone | C | clone | - | 16536120 | -28 |
| TSS clone | T | clone | - | 16536119 | -27 |
| TSS clone | T | clone | - | 16536116 | -24 |
| TSS clone | G | clone | - | 16536113 | -21 |
| TSS clone | A | clone | - | 16536106 | -14 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CTTTCTTCTC | - | 16536122 | 16536131 | -30 | -39 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | AAAAAGCC | - | 16536170 | 16536177 | -78 | -85 | |||
| AtREG589 | AAAAAGCC | PPDB Motif | PLACE Motif | ||||||
| REG | TGGCCCAACATGGCCCATCT | - | 16536223 | 16536242 | -131 | -150 | |||
| AtREG420 | TGGCCCAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG449 | GGCCCAAC | PPDB Motif | GCCCA, CCAACGG | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG543 | GCCCAACA | PPDB Motif | GCCCA | PLACE Motif | CAACA | ||||
| AtREG437 | ATGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG490 | TGGCCCAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG403 | GGCCCATC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG572 | GCCCATCT | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | CTAATGGGCTTA | - | 16536270 | 16536281 | -178 | -189 | |||
| AtREG558 | CTAATGGG | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG357 | TAATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG372 | AATGGGCT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG378 | ATGGGCTT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG426 | TGGGCTTA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||