version
PlantPromoterDB promoter information of AT4G35785.1

Summary of Gene (AT4G35785.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G35785  TAIR      NCBI 
Gene model AT4G35785.1  
Description nucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 16956127-16954928)

Genome position     
from initiation codon
AT4G35785.2         
AT4G35785.3         
AT4G35790.1         
AT4G35790.2         
AT4G35790.3         
TSS from cDNA
TSS information
AT4G35785.1                      5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G35785.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA36-16955219-92

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-16955230-103
TSS cloneAclone-16955218-91
TSS cloneGclone-16955216-89

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTATAAAAT-1695524516955252-118-125
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCGGAAA-1695535716955364-230-237
 AtREG644ACCGGAAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTAAACCGAACCA-1695537316955385-246-258
 AtREG473TTAAACCG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556   AACCGAAC   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451    ACCGAACC  PPDB Motif  PLACE Motif 
 AtREG655     CCGAACCA PPDB Motif  PLACE Motif 
REGCCGAACCAAACCGAA-1695543016955444-303-317
 AtREG655CCGAACCA        PPDB Motif  PLACE Motif 
 AtREG550     CCAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568       AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.