version
PlantPromoterDB promoter information of AT4G37300.1

Summary of Gene (AT4G37300.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G37300  TAIR      NCBI 
Gene model AT4G37300.1  
Description maternal effect embryo arrest 59 (MEE59); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 17553805-17555004)

Genome position     
from initiation codon
AT4G37295.1         
TSS from cDNA
TSS information
AT4G37300.1                      5'->3' (+)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G37300.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG17+17554774-31

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+17554641-164
TSS cloneAclone+17554753-52
TSS cloneTclone+17554757-48
TSS cloneTclone+17554763-42
TSS cloneGclone+17554768-37
TSS cloneCclone+17554769-36

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTTCTCT+1755475617554763-49-42
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAAGGCCCACTAAAAGCCCATATA+1755469117554715-114-90
 AtREG459AAAAGGCC                  PPDB Motif  PLACE Motif 
 AtREG359 AAAGGCCC                 PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG482   AGGCCCAC               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG532     GCCCACTA             PPDB MotifGCCCA  PLACE Motif 
 AtREG549           TAAAAGCC       PPDB Motif  PLACE Motif 
 AtREG409            AAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376             AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378              AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477               AGCCCATA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG432                GCCCATAT  PPDB MotifGCCCA  PLACE Motif 
 AtREG620                 CCCATATA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.