PlantPromoterDB promoter information of AT4G37450

Summary of Gene (AT4G37450)

Organism	Arabidopsis thaliana
Chromosome	4
Locus	AT4G37450 TAIR NCBI
Gene model	AT4G37450
Description	AGP18 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP17 and AGP19, other lysine-rich AGPs. It is expressed in young leaves, shoots, roots and flowers.

#

Overview

Focused view (chromosome 4: 17602284-17601085)

`Genome position from initiation codon` `TSS from cDNA TSS information AT4G37450 5'->3' (-) Promoter sequence AT4G37440.1 AT4G37440.2 TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G37450

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 4 - 17606826 -92

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	4	-	17606826	-92

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone - 17606829 -95

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	-	17606829	-95

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box CGCCTATATAAAAC - 17606854 17606867 -120 -133

Y Patch CTTCTCTT - 17606843 17606850 -109 -116

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`CGCCTATATAAAAC`	-	17606854	17606867	-120	-133
Y Patch	`CTTCTCTT`	-	17606843	17606850	-109	-116
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG ATCCAACG - 17606886 17606893 -152 -159

AtREG586 ATCCAACG PPDB Motif CCAACGG PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`ATCCAACG`		-	17606886	17606893	-152	-159
	AtREG586	`ATCCAACG`		PPDB Motif	`CCAACGG`	PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone G clone + 17601227 AT4G37440.1, AT4G37440.2

TSS clone peak A clone + 17601233 AT4G37440.1, AT4G37440.2

TSS clone A clone + 17601241 AT4G37440.1, AT4G37440.2

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`G`	clone	+	17601227	AT4G37440.1, AT4G37440.2
TSS clone peak	`A`	clone	+	17601233	AT4G37440.1, AT4G37440.2
TSS clone	`A`	clone	+	17601241	AT4G37440.1, AT4G37440.2

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch TCTCTCTCTCTCCC + 17601201 17601214 AT4G37440.1, AT4G37440.2

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`TCTCTCTCTCTCCC`	+	17601201	17601214	AT4G37440.1, AT4G37440.2
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG GGGTCAAA + 17601136 17601143 AT4G37440.1, AT4G37440.2

AtREG592 GGGTCAAA PPDB Motif PLACE Motif TTGAC, TTGACC