PlantPromoterDB promoter information of AT4G38510.4

Summary of Gene (AT4G38510.4)

Organism	Arabidopsis thaliana
Chromosome	4
Locus	AT4G38510 TAIR NCBI
Gene model	AT4G38510.4
Description	vacuolar ATP synthase subunit B, putative / V-ATPase B subunit, putative / vacuolar proton pump B subunit, putative / V-ATPase 57 kDa subunit, putative; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: proton transport, ATP metabolic process, ATP synthesis coupled proton transport; LOCATED IN: plasma membrane, vacuole, membrane, chloroplast envelope; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1/V1/A1 complex, alpha/beta subunit, C-terminal (InterPro:IPR000793), ATPase, F1/V1/A1 complex, alpha/beta subunit, N-terminal (InterPro:IPR004100), ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding (InterPro:IPR000194), ATPase, V1 complex, subunit B (InterPro:IPR005723); BEST Arabidopsis thaliana protein match is: vacuolar ATP synthase subunit B / V-ATPase B subunit / vacuolar proton pump B subunit / V-ATPase 57 kDa subunit (TAIR:AT1G76030.1); Has 29435 Blast hits to 28738 proteins in 7063 species: Archae - 684; Bacteria - 12531; Metazoa - 1350; Fungi - 553; Plants - 6688; Viruses - 0; Other Eukaryotes - 7629 (source: NCBI BLink).

#

Overview

Focused view (chromosome 4: 18015789-18014590)

`Genome position from initiation codon` `AT4G38510.1 AT4G38510.2 AT4G38510.3 AT4G38520.1 AT4G38520.2 TSS from cDNA TSS information AT4G38510.4 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G38510.4

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 13 - 18015134 -345

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	13	-	18015134	-345

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone - 18015137 -348

TSS clone A clone - 18015133 -344

TSS clone T clone - 18015130 -341

TSS clone T clone - 18015118 -329

TSS clone T clone - 18015114 -325

TSS clone T clone - 18015112 -323

TSS clone A clone - 18015000 -211

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	-	18015137	-348
TSS clone	`A`	clone	-	18015133	-344
TSS clone	`T`	clone	-	18015130	-341
TSS clone	`T`	clone	-	18015118	-329
TSS clone	`T`	clone	-	18015114	-325
TSS clone	`T`	clone	-	18015112	-323
TSS clone	`A`	clone	-	18015000	-211

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CTCCTTTCTTCCTCT - 18015095 18015109 -306 -320

Y Patch TCTCTCTCTT - 18015117 18015126 -328 -337

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CTCCTTTCTTCCTCT`	-	18015095	18015109	-306	-320
Y Patch	`TCTCTCTCTT`	-	18015117	18015126	-328	-337
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG CGTTGGAT - 18015285 18015292 -496 -503

AtREG586 CGTTGGAT PPDB Motif CCAACGG PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`CGTTGGAT`		-	18015285	18015292	-496	-503
	AtREG586	`CGTTGGAT`		PPDB Motif	`CCAACGG`	PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None