version
PlantPromoterDB promoter information of AT4G39090

Summary of Gene (AT4G39090)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G39090  TAIR      NCBI 
Gene model AT4G39090  
Description Similar to cysteine proteinases, induced by desiccation but not abscisic acid. Required for RRS1-R mediated resistance against Ralstonia solanacearum. Interacts with the R. solanacearum type III effector PopP2. RD19 associates with PopP2 to form a nuclear complex that is required for activation of the RRS1-R–mediated resistance response.  
#
#

Overview

Focused view (chromosome 4: 18210026-18208827)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G39090                        5'->3' (-)
Promoter sequence

 
AT4G39080.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence











 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G39090

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG281-18217335-9

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-18217481-155
TSS cloneAclone-18217392-66
TSS cloneCclone-18217384-58
TSS cloneAclone-18217381-55
TSS cloneAclone-18217344-18
TSS cloneCclone-18217341-15
TSS cloneAclone-18217339-13
TSS cloneAclone-18217338-12
TSS cloneTclone-18217337-11
TSS cloneGclone-18217335-9
TSS cloneCclone-18217334-8
TSS cloneAclone-18217333-7
TSS cloneAclone-18217332-6
TSS cloneAclone-18217331-5
TSS cloneAclone-18217328-2
TSS cloneAclone-18217327-1

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCCTTC-1821734518217352-19-26
Y PatchTCCTTCTCT-1821735418217362-28-36
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAACCGAA-1821746518217472-139-146
 AtREG568AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAACACGTGGT-1821761118217620-285-294
 AtREG590AACACGTG  ABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG382 ACACGTGG ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG544  CACGTGGTABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG20+18209401AT4G39080.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+18209402AT4G39080.1
TSS cloneGclone+18209417AT4G39080.1
TSS cloneCclone+18209420AT4G39080.1
TSS cloneTclone+18209421AT4G39080.1
TSS cloneTclone+18209423AT4G39080.1
TSS cloneTclone+18209430AT4G39080.1
TSS cloneAclone+18209432AT4G39080.1
TSS cloneTclone+18209433AT4G39080.1
TSS cloneTclone+18209436AT4G39080.1
TSS cloneAclone+18209438AT4G39080.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCCTCC+1820939118209400AT4G39080.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCATGGGCCAATATTGGG+1820917518209191AT4G39080.1
 AtREG504CATGGGCC          PPDB MotifGCCCA, CCATGG  PLACE MotifGGGCC, TGGGCY 
 AtREG490 ATGGGCCA         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484  TGGGCCAA        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG446   GGGCCAAT      CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG509         ATATTGGG PPDB Motif  PLACE Motif 
REGCCCAATTA+1820922218209229AT4G39080.1
 AtREG600CCCAATTA PPDB MotifGCCCA  PLACE Motif 
REGACCGAACCA+1820926618209274AT4G39080.1
 AtREG451ACCGAACC  PPDB Motif  PLACE Motif 
 AtREG655 CCGAACCA PPDB Motif  PLACE Motif 
REGGAAGCCCATTAAAAGCCCAATA+1820928018209301AT4G39080.1
 AtREG476GAAGCCCA               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372  AGCCCATT             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357   GCCCATTA            PPDB MotifGCCCA  PLACE Motif 
 AtREG396    CCCATTAA           PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG549         TAAAAGCC      PPDB Motif  PLACE Motif 
 AtREG409          AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376           AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407            AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402             AGCCCAAT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355              GCCCAATA PPDB MotifGCCCA  PLACE Motif 
REGGAGCCCAA+1820932518209332AT4G39080.1
 AtREG533GAGCCCAA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGAGGGGTAA+1820933418209341AT4G39080.1
 AtREG642AGGGGTAA PPDB MotifACCCCT  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.