PlantPromoterDB promoter information of AT5G01110.1
Summary of Gene (AT5G01110.1)
|
Overview
|
Focused view (chromosome 5: 45303-44104)
|
Genome position
from initiation codon TSS from cDNA TSS information AT5G01110.1 5'->3' (-) Promoter sequence AT5G01120.1
TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT5G01110.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone peak | A | clone | - | 44375 | -72 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CTCTTCTCTC | - | 44406 | 44415 | -103 | -112 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | ACGTCGTCGTTTA | - | 44431 | 44443 | -128 | -140 | |||
| AtREG526 | ACGTCGTC | PPDB Motif | ACGT | PLACE Motif | ACGT | ||||
| AtREG648 | TCGTCGTT | PPDB Motif | PLACE Motif | ||||||
| AtREG415 | CGTCGTTT | PPDB Motif | PLACE Motif | ||||||
| AtREG565 | GTCGTTTA | PPDB Motif | PLACE Motif | ||||||
| REG | TCAGCCCAATTAAAACCGGAT | - | 44461 | 44481 | -158 | -178 | |||
| AtREG609 | TCAGCCCA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG402 | AGCCCAAT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG418 | GCCCAATT | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG600 | CCCAATTA | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG542 | AAAACCGG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG521 | AAACCGGA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG561 | AACCGGAT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| REG | TAATTGGGCCAT | - | 44495 | 44506 | -192 | -203 | |||
| AtREG600 | TAATTGGG | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG418 | AATTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG352 | ATTGGGCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG420 | TTGGGCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG437 | TGGGCCAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| REG | GGCTTTTT | - | 44518 | 44525 | -215 | -222 | |||
| AtREG589 | GGCTTTTT | PPDB Motif | PLACE Motif | ||||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||