version
PlantPromoterDB promoter information of AT5G02280.1

Summary of Gene (AT5G02280.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G02280  TAIR      NCBI 
Gene model AT5G02280.1  
Description synbindin, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport, ER to Golgi vesicle-mediated transport; LOCATED IN: cis-Golgi network; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sybindin-like protein (InterPro:IPR007233), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: synbindin, putative (TAIR:AT1G51160.2); Has 419 Blast hits to 413 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 194; Fungi - 100; Plants - 56; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 468377-469576)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G02280.1                      5'->3' (+)
Promoter sequence







 
AT5G02270.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G02280.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+469298-79
TSS clone peakGclone+469331-46
TSS cloneCclone+469332-45

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAAACGACACC+469132469142-245-235
 AtREG576GAAACGAC    PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA   PPDB Motif  PLACE Motif 
 AtREG527  AACGACAC DREB1Aox PPDB Motif  PLACE Motif 
 AtREG599   ACGACACC PPDB Motif  PLACE Motif 
REGCACGTGGCG+469173469181-204-196
 AtREG367CACGTGGC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG371 ACGTGGCGABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
REGGACGACGTCGTT+469208469219-169-158
 AtREG526GACGACGT     PPDB MotifACGT  PLACE MotifACGT 
 AtREG431 ACGACGTCGT  PPDB MotifACGT  PLACE MotifACGT 
 AtREG493    ACGTCGTT PPDB MotifACGT  PLACE MotifACGT 
REGCGACGTGGCG+469232469241-145-136
 AtREG465CGACGTGG   PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG388 GACGTGGC  PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG371  ACGTGGCGABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
REGAACGACGCCGTTTTGA+469265469280-112-97
 AtREG439AACGACGC         PPDB Motif  PLACE Motif 
 AtREG537 ACGACGCC        PPDB Motif  PLACE Motif 
 AtREG540   GACGCCGT      PPDB Motif  PLACE Motif 
 AtREG497    ACGCCGTT     PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
 AtREG524     CGCCGTTT    PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG531      GCCGTTTT   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG653        CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA10-469048AT5G02270.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-469053AT5G02270.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGTGTCGTTTC-469132469142AT5G02270.1
 AtREG599GGTGTCGT    PPDB Motif  PLACE Motif 
 AtREG527 GTGTCGTT  DREB1Aox PPDB Motif  PLACE Motif 
 AtREG569  TGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG576   GTCGTTTC PPDB Motif  PLACE Motif 
REGCGCCACGTG-469173469181AT5G02270.1
 AtREG371CGCCACGT ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG367 GCCACGTGABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
REGAACGACGTCGTC-469208469219AT5G02270.1
 AtREG493AACGACGT     PPDB MotifACGT  PLACE MotifACGT 
 AtREG431 ACGACGTCGT  PPDB MotifACGT  PLACE MotifACGT 
 AtREG526    ACGTCGTC PPDB MotifACGT  PLACE MotifACGT 
REGCGCCACGTCG-469232469241AT5G02270.1
 AtREG371CGCCACGT  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG388 GCCACGTC  PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG465  CCACGTCG PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGTCAAAACGGCGTCGTT-469265469280AT5G02270.1
 AtREG653TCAAAACG         PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG531  AAAACGGC       PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG524   AAACGGCG      PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG497    AACGGCGT     PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
 AtREG540     ACGGCGTC    PPDB Motif  PLACE Motif 
 AtREG537       GGCGTCGT  PPDB Motif  PLACE Motif 
 AtREG439        GCGTCGTT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.