version
PlantPromoterDB promoter information of AT5G02450

Summary of Gene (AT5G02450)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G02450  TAIR      NCBI 
Gene model AT5G02450  
Description 60S ribosomal protein L36 (RPL36C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36B) (TAIR:AT3G53740.4); Has 585 Blast hits to 585 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 95; Plants - 95; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 532501-533700)

Genome position     
from initiation codon
AT5G02440.1         
AT5G02450.1         
TSS from cDNA
TSS information
AT5G02450                        5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G02450

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG10+533159-342

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+533152-349
TSS cloneTclone+533153-348
TSS cloneCclone+533154-347
TSS cloneTclone+533155-346
TSS cloneGclone+533159-342
TSS cloneAclone+533160-341
TSS cloneCclone+533161-340
TSS cloneGclone+533166-335

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxACTATAAAAT+533118533127-383-374
Y PatchTTTCTCTC+533132533139-369-362
Y PatchTCTCTTTC+533151533158-350-343
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTATTGGGCCTC+532923532934-578-567
 AtREG417TTATTGGG     PPDB MotifGCCCA  PLACE Motif 
 AtREG355 TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   TTGGGCCT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG447    TGGGCCTC PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGATAAGGCCCAAAA+532962532974-539-527
 AtREG425ATAAGGCC      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG351 TAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373    GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG529     GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGTTAAAGCCCA+532993533002-508-499
 AtREG545TTAAAGCC   PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC  PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGGTTTGGGCCCAACA+533019533032-482-469
 AtREG474GTTTGGGC       PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422   TGGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392  TTGGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG449     GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG543      GCCCAACA PPDB MotifGCCCA  PLACE MotifCAACA 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.