version
PlantPromoterDB promoter information of AT5G02710.1

Summary of Gene (AT5G02710.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G02710  TAIR      NCBI 
Gene model AT5G02710.1  
Description unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0153 (InterPro:IPR005358); Has 211 Blast hits to 211 proteins in 60 species: Archae - 8; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 611628-612827)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G02710.1                      5'->3' (+)
Promoter sequence



 
AT5G02700.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G02710.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+612609-19

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAACGCGTGT+612375612384-253-244
 AtREG633AAACGCGT   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG536  ACGCGTGTABA, Drought PPDB Motif  PLACE MotifACACNNG 
REGTGAACCGGAT+612491612500-137-128
 AtREG480TGAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579 GAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561  AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTGAACCGGAT+612520612529-108-99
 AtREG480TGAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579 GAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561  AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTGAACCGGC+612549612558-79-70
 AtREG640TTGAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480 TGAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG637  GAACCGGC PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.