version
PlantPromoterDB promoter information of AT5G02970.1

Summary of Gene (AT5G02970.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G02970  TAIR      NCBI 
Gene model AT5G02970.1  
Description hydrolase, alpha/beta fold family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT3G09690.2); Has 537 Blast hits to 531 proteins in 131 species: Archae - 2; Bacteria - 272; Metazoa - 8; Fungi - 13; Plants - 197; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 694391-695590)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G02970.1                      5'->3' (+)
Promoter sequence

 
AT5G02960.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence










 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G02970.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2+694979-412

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+694969-422
TSS cloneGclone+694982-409

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAACCGGC+694768694775-623-616
 AtREG637GAACCGGC PPDB MotifAACCG(G/A)  PLACE Motif 
REGCTTAACCG+694849694856-542-535
 AtREG605CTTAACCG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGACGTGGAC+694876694883-515-508
 AtREG513ACGTGGACABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA161-694485AT5G02960.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-694485AT5G02960.1
TSS cloneGclone-694484AT5G02960.1
TSS cloneGclone-694483AT5G02960.1
TSS cloneGclone-694482AT5G02960.1
TSS cloneTclone-694481AT5G02960.1
TSS cloneGclone-694473AT5G02960.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTGATGGGCCAA-694553694563AT5G02960.1
 AtREG635TGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG403 GATGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490  ATGGGCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484   TGGGCCAA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGCTTAATGGGCCTAC-694568694581AT5G02960.1
 AtREG604CTTAATGG       PPDB Motif  PLACE MotifTTAATGG 
 AtREG396 TTAATGGG      PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357  TAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG361   AATGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354    ATGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358     TGGGCCTA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG435      GGGCCTAC PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTAAAAGCCCAT-694584694594AT5G02960.1
 AtREG549TAAAAGCC    PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC   PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTAAAAGCCCAAAA-694632694644AT5G02960.1
 AtREG549TAAAAGCC      PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469    AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG529     GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGATCCAACGGTTTAG-694656694669AT5G02960.1
 AtREG586ATCCAACG       PPDB MotifCCAACGG  PLACE Motif 
 AtREG554 TCCAACGG      PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
 AtREG652     ACGGTTTA  PPDB Motif  PLACE Motif 
 AtREG511      CGGTTTAG PPDB MotifAACCG(G/A)  PLACE Motif 
REGGCCGGTTC-694768694775AT5G02960.1
 AtREG637GCCGGTTC PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.