version
PlantPromoterDB promoter information of AT5G03080.1

Summary of Gene (AT5G03080.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G03080  TAIR      NCBI 
Gene model AT5G03080.1  
Description phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); Has 539 Blast hits to 533 proteins in 226 species: Archae - 7; Bacteria - 211; Metazoa - 103; Fungi - 102; Plants - 38; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 720976-722175)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G03080.1                      5'->3' (+)
Promoter sequence





 
AT5G03070.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G03080.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13+721860-116

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+721860-116
TSS cloneCclone+721861-115
TSS cloneAclone+721897-79

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAATAGCCCATTTA+721610721622-366-354
 AtREG584AATAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG581  TAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372   AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386    GCCCATTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG443     CCCATTTA PPDB MotifGCCCA  PLACE Motif 
REGTACACGTGTCAC+721786721797-190-179
 AtREG453TACACGTG    ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACACNNG 
 AtREG366  CACGTGTC  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG389   ACGTGTCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG498    CGTGTCACABA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-721539AT5G03070.1
TSS clone peakCclone-721525AT5G03070.1
TSS cloneGclone-721518AT5G03070.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAAATGGGCTATT-721610721622AT5G03070.1
 AtREG443TAAATGGG      PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581   ATGGGCTA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG584     GGGCTATT PPDB MotifGCCCA  PLACE Motif 
REGGTGACACGTGTA-721786721797AT5G03070.1
 AtREG498GTGACACG    ABA PPDB Motif  PLACE Motif 
 AtREG389 TGACACGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG366  GACACGTG  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG453    CACGTGTAABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACACNNG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.