version
PlantPromoterDB promoter information of AT5G04760.1

Summary of Gene (AT5G04760.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G04760  TAIR      NCBI 
Gene model AT5G04760.1  
Description myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT3G11280.2); Has 832 Blast hits to 830 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 2; Plants - 757; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 1372729-1371530)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G04760.1                      5'->3' (-)
Promoter sequence

 
AT5G04750.1         
AT5G04750.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G04760.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-1374749-220
TSS clone peakAclone-1374748-219
TSS cloneAclone-1374733-204
TSS clone peakAclone-1374589-60

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCGTATAAATT-13746161374626-87-97
Y PatchTTTCTTCTTCTCT-13745521374564-23-35
Y PatchCTTCTTCCTTC-13747051374715-176-186
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCAATTG-13747501374757-221-228
 AtREG647CCCAATTG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG23+1372175AT5G04750.1, AT5G04750.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+1372155AT5G04750.1, AT5G04750.2
TSS cloneAclone+1372156AT5G04750.1, AT5G04750.2
TSS cloneGclone+1372175AT5G04750.1, AT5G04750.2
TSS cloneTclone+1372185AT5G04750.1, AT5G04750.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACGTCAGC-13716901371697AT5G04740.1
 AtREG515ACGTCAGCSA PPDB MotifACGT  PLACE MotifACGT 
REGCTTGGGCCAT+13719491371958AT5G04750.1, AT5G04750.2
 AtREG505CTTGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420 TTGGGCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG437  TGGGCCAT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGCTATTGGGCTATT+13720001372012AT5G04750.1, AT5G04750.2
 AtREG624CTATTGGG      PPDB MotifGCCCA  PLACE Motif 
 AtREG355 TATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG584     GGGCTATT PPDB MotifGCCCA  PLACE Motif 
REGTAGCCCATTG+13720141372023AT5G04750.1, AT5G04750.2
 AtREG581TAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372 AGCCCATT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG551  GCCCATTG PPDB MotifGCCCA  PLACE Motif 
REGACCCGACCCGGT+13720961372107AT5G04750.1, AT5G04750.2
 AtREG405ACCCGACC     PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG442 CCCGACCC    PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG375  CCGACCCG   PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG494   CGACCCGG  PPDB Motif  PLACE Motif 
 AtREG463    GACCCGGT PPDB MotifAACCG(G/A), GGGACCC  PLACE Motif 
REGCGGACCCGAA+13721091372118AT5G04750.1, AT5G04750.2
 AtREG491CGGACCCG   PPDB Motif  PLACE Motif 
 AtREG597  GACCCGAA PPDB MotifGGGACCC  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.