PlantPromoterDB promoter information of AT5G05590.2
Summary of Gene (AT5G05590.2)
|
Overview
|
Focused view (chromosome 5: 1669214-1668015)
|
Genome position
from initiation codon TSS from cDNA TSS information AT5G05590.2 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT5G05590.2
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone peak | A | clone | - | 1668331 | -117 |
| TSS clone peak | G | clone | - | 1668311 | -97 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CCTTCTCTTCTC | - | 1668272 | 1668283 | -58 | -69 |
| Y Patch | TCTTCTTC | - | 1668313 | 1668320 | -99 | -106 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | TTCGGTTTGGTTCGGTTTAA | - | 1668378 | 1668397 | -164 | -183 | |||
| AtREG568 | TTCGGTTT TTCGGTTT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG550 | CGGTTTGG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG655 | TGGTTCGG | PPDB Motif | PLACE Motif | ||||||
| AtREG451 | GGTTCGGT | PPDB Motif | PLACE Motif | ||||||
| AtREG556 | GTTCGGTT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG514 | TCGGTTTA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG473 | CGGTTTAA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| REG | TTCGGTTT | - | 1668426 | 1668433 | -212 | -219 | |||
| AtREG568 | TTCGGTTT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| REG | AAACCGAA | - | 1668448 | 1668455 | -234 | -241 | |||
| AtREG568 | AAACCGAA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||