PlantPromoterDB promoter information of AT5G05600

Summary of Gene (AT5G05600)

Organism	Arabidopsis thaliana
Chromosome	5
Locus	AT5G05600 TAIR NCBI
Gene model	AT5G05600
Description	oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, iron ion binding; INVOLVED IN: response to salt stress; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT3G11180.1); Has 6078 Blast hits to 6039 proteins in 692 species: Archae - 0; Bacteria - 730; Metazoa - 123; Fungi - 674; Plants - 3117; Viruses - 0; Other Eukaryotes - 1434 (source: NCBI BLink).

#

Overview

Focused view (chromosome 5: 1667216-1668415)

`Genome position from initiation codon` `TSS from cDNA TSS information AT5G05600 5'->3' (+) Promoter sequence AT5G05590.1 AT5G05590.2 TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G05600

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone T clone + 1672194 -72

TSS clone peak T clone + 1672196 -70

TSS clone A clone + 1672249 -17

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`T`	clone	+	1672194	-72
TSS clone peak	`T`	clone	+	1672196	-70
TSS clone	`A`	clone	+	1672249	-17

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box TCTTTATATA + 1672210 1672219 -56 -47

Y Patch CCTCTTCTT + 1672205 1672213 -61 -53

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`TCTTTATATA`	+	1672210	1672219	-56	-47
Y Patch	`CCTCTTCTT`	+	1672205	1672213	-61	-53
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG TCACACGT + 1672075 1672082 -191 -184

AtREG588 TCACACGT ABA PPDB Motif ACGT PLACE Motif ACGT, ACGTG

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`TCACACGT`		+	1672075	1672082	-191	-184
	AtREG588	`TCACACGT`	ABA	PPDB Motif	`ACGT`	PLACE Motif	`ACGT, ACGTG`

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone peak A clone - 1668331 AT5G05590.2, AT5G05590.1

TSS clone peak G clone - 1668311 AT5G05590.2, AT5G05590.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone peak	`A`	clone	-	1668331	AT5G05590.2, AT5G05590.1
TSS clone peak	`G`	clone	-	1668311	AT5G05590.2, AT5G05590.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CCTTCTCTTCTC - 1668272 1668283 AT5G05590.1, AT5G05590.2

Y Patch TCTTCTTC - 1668313 1668320 AT5G05590.1, AT5G05590.2

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CCTTCTCTTCTC`	-	1668272	1668283	AT5G05590.1, AT5G05590.2
Y Patch	`TCTTCTTC`	-	1668313	1668320	AT5G05590.1, AT5G05590.2
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG TTCGGTTTGGTTCGGTTTAA - 1668378 1668397 AT5G05590.1, AT5G05590.2

AtREG568 TTCGGTTT  TTCGGTTT   PPDB Motif AACCG(G/A) PLACE Motif

AtREG550   CGGTTTGG           PPDB Motif AACCG(G/A) PLACE Motif

AtREG655        TGGTTCGG      PPDB Motif PLACE Motif

AtREG451         GGTTCGGT     PPDB Motif PLACE Motif

AtREG556          GTTCGGTT    PPDB Motif AACCG(G/A) PLACE Motif

AtREG514            TCGGTTTA PPDB Motif AACCG(G/A) PLACE Motif

AtREG473             CGGTTTAA PPDB Motif AACCG(G/A) PLACE Motif