version
PlantPromoterDB promoter information of AT5G05690

Summary of Gene (AT5G05690)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G05690  TAIR      NCBI 
Gene model AT5G05690  
Description Encodes a member of the CP90A family, a cytochrome P450 monooxygenase which converts 6-deoxocathasterone to 6-deoxoteasterone in the late C6 oxidation pathway and cathasterone to teasterone in the early C6 oxidation pathway of brassinolide biosynthesis. Expressed in cotyledons and leaves. Mutants display de-etiolation and derepression of light-induced genes in the dark, dwarfism, male sterility and activation of stress-regulated genes in the light. The expression of the gene using a CPD promoter:LUC fusion construct was shown to be under circadian and light control. Additionally, the circadian regulation was shown to be independent of BR levels as it remains unchanged in <i>bri1</i> mutant lines. CPD appears to be involved in the autonomous pathway that regulates the transition to flowering, primarily through a BRI1-mediated signaling pathway that affects FLC expression levels, as uncovered by double mutant analyses.  
#
#

Overview

Focused view (chromosome 5: 1707705-1706506)

Genome position     
from initiation codon
AT5G05690.1         
AT5G05690.2         
AT5G05690.3         
TSS from cDNA
TSS information
AT5G05690                        5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G05690

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4-1706586119

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-1706787-82
TSS cloneTclone-1706784-79
TSS cloneCclone-1706770-65
TSS cloneAclone-1706762-57
TSS cloneTclone-1706761-56
TSS cloneCclone-1706729-24
TSS cloneTclone-1706728-23
TSS cloneTclone-1706726-21
TSS cloneAclone-1706724-19
TSS cloneTclone-1706723-18
TSS cloneTclone-1706720-15
TSS cloneCclone-170669510

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCCTCT-17065871706594118111
Y PatchTTCTCCTCCTCCTCTCTT-170667217066893316
Y PatchTCTTCTTCTTC-17067071706717-2-12
Y PatchTCCTCTCTTCTTCTCTCAT-17067231706741-18-36
Y PatchCTCTCTCTCCC-17067451706755-40-50
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTACACGT-170663117066387467
 AtREG562GTACACGTABA, Auxin PPDB MotifACGT  PLACE MotifACGT, ACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.