version
PlantPromoterDB promoter information of AT5G07840.1

Summary of Gene (AT5G07840.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G07840  TAIR      NCBI 
Gene model AT5G07840.1  
Description ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: pollen tube; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT5G61230.1); Has 50208 Blast hits to 17627 proteins in 653 species: Archae - 46; Bacteria - 2813; Metazoa - 29912; Fungi - 2863; Plants - 1606; Viruses - 449; Other Eukaryotes - 12519 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 2508291-2507092)

Genome position     
from initiation codon
AT5G07842.1         
TSS from cDNA
TSS information
AT5G07840.1                      5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G07840.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakC2-2508229-938

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTTCTTCTCCCTCC-25082332508250-942-959
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCACGCGCC-25083752508383-1084-1092
 AtREG395TCACGCGC  PPDB MotifACGCGC  PLACE Motif 
 AtREG486 CACGCGCC PPDB MotifACGCGC  PLACE Motif 
REGGTAGGCCCAACA-25084922508503-1201-1212
 AtREG435GTAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358 TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG449   GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG543    GCCCAACA PPDB MotifGCCCA  PLACE MotifCAACA 
REGGGCCTTTT-25085072508514-1216-1223
 AtREG459GGCCTTTT PPDB Motif  PLACE Motif 
REGTCTGGGCCAA-25085202508529-1229-1238
 AtREG397TCTGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG458 CTGGGCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484  TGGGCCAA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.