version
PlantPromoterDB promoter information of AT5G09260.1

Summary of Gene (AT5G09260.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G09260  TAIR      NCBI 
Gene model AT5G09260.1  
Description VACUOLAR PROTEIN SORTING-ASSOCIATED PROTEIN 20.2 (VPS20.2); INVOLVED IN: vesicle-mediated transport, N-terminal protein myristoylation; LOCATED IN: ESCRT III complex, plasma membrane; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: VPS20.1 (TAIR:AT5G63880.1); Has 1386 Blast hits to 1365 proteins in 199 species: Archae - 19; Bacteria - 54; Metazoa - 638; Fungi - 238; Plants - 140; Viruses - 5; Other Eukaryotes - 292 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 2875797-2876996)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G09260.1                      5'->3' (+)
Promoter sequence

 
AT5G09250.1         
AT5G09250.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G09260.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+2876754-43

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGGCGCGT+28765802876587-217-210
 AtREG538CGGCGCGT PPDB MotifACGCGC  PLACE Motif 
REGCACGCGCT+28766242876631-173-166
 AtREG381CACGCGCT PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4-2876565AT5G09250.1, AT5G09250.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-2876575AT5G09250.1, AT5G09250.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAGCGCGTG-28766242876631AT5G09250.1, AT5G09250.2
 AtREG381AGCGCGTG PPDB MotifACGCGC  PLACE Motif 
REGCGCGTTTT-28767102876717AT5G09250.1, AT5G09250.2
 AtREG566CGCGTTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGTTCGGTTT-28768182876825AT5G09250.1, AT5G09250.2
 AtREG568TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.