version
PlantPromoterDB promoter information of AT5G09300.2

Summary of Gene (AT5G09300.2)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G09300  TAIR      NCBI 
Gene model AT5G09300.2  
Description 2-oxoisovalerate dehydrogenase, putative / 3-methyl-2-oxobutanoate dehydrogenase, putative / branched-chain alpha-keto acid dehydrogenase E1 alpha subunit, putative; FUNCTIONS IN: oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor, 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity; INVOLVED IN: metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Dehydrogenase, E1 component (InterPro:IPR001017); BEST Arabidopsis thaliana protein match is: 2-oxoisovalerate dehydrogenase, putative / 3-methyl-2-oxobutanoate dehydrogenase, putative / branched-chain alpha-keto acid dehydrogenase E1 alpha subunit, putative (TAIR:AT1G21400.1); Has 5958 Blast hits to 5956 proteins in 1027 species: Archae - 48; Bacteria - 2954; Metazoa - 450; Fungi - 159; Plants - 112; Viruses - 0; Other Eukaryotes - 2235 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 2887291-2886092)

Genome position     
from initiation codon
AT5G09300.1         
AT5G09310.1         
TSS from cDNA
TSS information
AT5G09300.2                      5'->3' (-)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G09300.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG2-2886783-492

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-2886863-572
TSS cloneTclone-2886827-536

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTCT-28868292886837-538-546
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGGCTTAT-28869582886967-667-676
 AtREG518GTGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426 TGGGCTTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG462  GGGCTTAT PPDB MotifGCCCA  PLACE Motif 
REGTAGTGGGCCAT-28869792886989-688-698
 AtREG532TAGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG437   TGGGCCAT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGGTCGTTTT-28869932887000-702-709
 AtREG520GTCGTTTT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.