version
PlantPromoterDB promoter information of AT5G09590.1

Summary of Gene (AT5G09590.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G09590  TAIR      NCBI 
Gene model AT5G09590.1  
Description heat shock protein 70 (Hsc70-5); nuclear  
#
#

Overview

Focused view (chromosome 5: 2974721-2975920)

Genome position     
from initiation codon
AT5G09580.1         
AT5G09585           
AT5G09585.1         
TSS from cDNA
TSS information
AT5G09590.1                      5'->3' (+)
Promoter sequence








 
AT5G09585.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G09590.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4+2975649-72

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+2975548-173
TSS cloneAclone+2975575-146
TSS cloneTclone+2975576-145
TSS cloneCclone+2975654-67
TSS cloneAclone+2975655-66

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTCCACGTGGCAAT+29754672975480-254-241
 AtREG627TTCCACGT       PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG408 TCCACGTG     ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG367   CACGTGGC   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG379    ACGTGGCA  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG452     CGTGGCAA  PPDB Motif  PLACE MotifGCCAC 
 AtREG654      GTGGCAAT PPDB Motif  PLACE MotifGCCAC 
REGTAAACGACGTCGTTTC+29755192975534-202-187
 AtREG565TAAACGAC         PPDB Motif  PLACE Motif 
 AtREG415 AAACGACGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG493  AACGACGTCGTT   PPDB MotifACGT  PLACE MotifACGT 
 AtREG431   ACGACGTCGT    PPDB MotifACGT  PLACE MotifACGT 
 AtREG576        GTCGTTTC PPDB Motif  PLACE Motif 
REGCGATGTCG+29755552975562-166-159
 AtREG630CGATGTCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.