PlantPromoterDB promoter information of AT5G09660.1
Summary of Gene (AT5G09660.1)
|
Overview
|
Focused view (chromosome 5: 2996551-2995352)
|
Genome position
from initiation codon AT5G09670.1 AT5G09670.2 AT5G09672.1 TSS from cDNA TSS information AT5G09660.1 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT5G09660.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 8 | - | 2995691 | -140 |
| TSS peak | G | 23 | - | 2995575 | -24 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | T | clone | - | 2995650 | -99 |
| TSS clone | T | clone | - | 2995643 | -92 |
| TSS clone | G | clone | - | 2995641 | -90 |
| TSS clone | T | clone | - | 2995634 | -83 |
| TSS clone | A | clone | - | 2995603 | -52 |
| TSS clone | A | clone | - | 2995602 | -51 |
| TSS clone | T | clone | - | 2995601 | -50 |
| TSS clone | A | clone | - | 2995599 | -48 |
| TSS clone | A | clone | - | 2995598 | -47 |
| TSS clone | A | clone | - | 2995577 | -26 |
| TSS clone | A | clone | - | 2995574 | -23 |
| TSS clone | G | clone | - | 2995573 | -22 |
| TSS clone | G | clone | - | 2995570 | -19 |
| TSS clone | A | clone | - | 2995569 | -18 |
| TSS clone | A | clone | - | 2995563 | -12 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | CAACGGTC | - | 2995774 | 2995781 | -223 | -230 | |||
| AtREG553 | CAACGGTC | Auxin | PPDB Motif | CCAACGG | PLACE Motif | YAACKG, CNGTTR | |||
| REG | TATGGGCCTTTAGTGGGCTTC | - | 2995869 | 2995889 | -318 | -338 | |||
| AtREG364 | TATGGGCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG354 | ATGGGCCT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG353 | TGGGCCTT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG359 | GGGCCTTT | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG467 | GGCCTTTA | PPDB Motif | PLACE Motif | ||||||
| AtREG532 | TAGTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG510 | AGTGGGCT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG518 | GTGGGCTT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG476 | TGGGCTTC | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| REG | TAAACGGCA | - | 2995891 | 2995899 | -340 | -348 | |||
| AtREG613 | TAAACGGC | PPDB Motif | AAACG(C/G) | PLACE Motif | |||||
| AtREG500 | AAACGGCA | PPDB Motif | AAACG(C/G) | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS clone | A | clone | - | 2995551 | AT5G09660.2, AT5G09660.3 |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||