version
PlantPromoterDB promoter information of AT5G09680.2

Summary of Gene (AT5G09680.2)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G09680  TAIR      NCBI 
Gene model AT5G09680.2  
Description cytochrome b5 domain-containing protein; FUNCTIONS IN: heme binding; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome b5, heme-binding site (InterPro:IPR018506), Cytochrome b5 (InterPro:IPR001199); BEST Arabidopsis thaliana protein match is: CB5-A (CYTOCHROME B5 ISOFORM A); heme binding (TAIR:AT1G26340.1); Has 2233 Blast hits to 2217 proteins in 344 species: Archae - 1; Bacteria - 7; Metazoa - 608; Fungi - 741; Plants - 527; Viruses - 0; Other Eukaryotes - 349 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 3001185-2999986)

Genome position     
from initiation codon
AT5G09680.1         
AT5G09690.1         
AT5G09690.2         
AT5G09690.3         
AT5G09690.4         
TSS from cDNA
TSS information
AT5G09680.2                      5'->3' (-)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G09680.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4-3000601-416

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-3000599-414

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCCCTCTTTC-30005523000565-367-380
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAACCGAA-30006533000660-468-475
 AtREG568AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAACCGAACCA-30006943000703-509-518
 AtREG556AACCGAAC   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451 ACCGAACC  PPDB Motif  PLACE Motif 
 AtREG655  CCGAACCA PPDB Motif  PLACE Motif 
REGAAAACCGG-30007423000749-557-564
 AtREG542AAAACCGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGAACCGAAC-30007793000786-594-601
 AtREG556AACCGAAC PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.