PlantPromoterDB promoter information of AT5G10260.1

Summary of Gene (AT5G10260.1)

Organism	Arabidopsis thaliana
Chromosome	5
Locus	AT5G10260 TAIR NCBI
Gene model	AT5G10260.1
Description	Arabidopsis Rab GTPase homolog H1e (AtRABH1e); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab6-related (InterPro:IPR015600); BEST Arabidopsis thaliana protein match is: ATRABH1D (ARABIDOPSIS RAB GTPASE HOMOLOG H1D); GTP binding (TAIR:AT2G22290.1); Has 21717 Blast hits to 21689 proteins in 604 species: Archae - 17; Bacteria - 112; Metazoa - 12246; Fungi - 2563; Plants - 1861; Viruses - 19; Other Eukaryotes - 4899 (source: NCBI BLink).

#

Overview

Focused view (chromosome 5: 3215791-3216990)

`Genome position from initiation codon` `TSS from cDNA TSS information AT5G10260.1 5'->3' (+) Promoter sequence AT5G10240.1 AT5G10240.2 TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G10260.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone T clone - 3216466 AT5G10240.1, AT5G10240.2

TSS clone C clone - 3216464 AT5G10240.1, AT5G10240.2

TSS clone peak T clone - 3216448 AT5G10240.1, AT5G10240.2

TSS clone T clone - 3216445 AT5G10240.1, AT5G10240.2

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`T`	clone	-	3216466	AT5G10240.1, AT5G10240.2
TSS clone	`C`	clone	-	3216464	AT5G10240.1, AT5G10240.2
TSS clone peak	`T`	clone	-	3216448	AT5G10240.1, AT5G10240.2
TSS clone	`T`	clone	-	3216445	AT5G10240.1, AT5G10240.2

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG CAACGGTC - 3216523 3216530 AT5G10240.1, AT5G10240.2

AtREG553 CAACGGTC Auxin PPDB Motif CCAACGG PLACE Motif YAACKG, CNGTTR

REG TCAAAACGCGTCGTTTT - 3216684 3216700 AT5G10240.1, AT5G10240.2

AtREG653 TCAAAACG          PPDB Motif AAACG(C/G) PLACE Motif

AtREG585 CAAAACGC         PPDB Motif AAACG(C/G) PLACE Motif CAAAACGC

AtREG566   AAAACGCG        PPDB Motif AAACG(C/G) PLACE Motif

AtREG633    AAACGCGT       PPDB Motif AAACG(C/G) PLACE Motif

AtREG439        GCGTCGTT   PPDB Motif PLACE Motif

AtREG415         CGTCGTTT PPDB Motif PLACE Motif

AtREG520          GTCGTTTT PPDB Motif PLACE Motif

REG CGACATCG - 3216722 3216729 AT5G10240.1, AT5G10240.2

AtREG630 CGACATCG PPDB Motif PLACE Motif