version
PlantPromoterDB promoter information of AT5G11240.1

Summary of Gene (AT5G11240.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G11240  TAIR      NCBI 
Gene model AT5G11240.1  
Description transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Protein of unknown function NUC189, C-terminal (InterPro:IPR012979), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 6246 Blast hits to 3792 proteins in 274 species: Archae - 28; Bacteria - 2331; Metazoa - 1477; Fungi - 1133; Plants - 291; Viruses - 0; Other Eukaryotes - 986 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 3581949-3583148)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G11240.1                      5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G11240.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone+3582614-335
TSS clone peakTclone+3582615-334

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTTCTTCTTCTTC+35826063582619-343-330
Y PatchCTCTTCTCTTCC+35826443582655-305-294
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGGCTTTAT+35823823582392-567-557
 AtREG518GTGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376 TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365  GGGCTTTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG601   GGCTTTAT PPDB Motif  PLACE Motif 
REGATAAGCCCACTA+35824003582411-549-538
 AtREG462ATAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG426 TAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518  AAGCCCAC   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG510   AGCCCACT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG532    GCCCACTA PPDB MotifGCCCA  PLACE Motif 
REGATAAGGCCCGTTA+35824433582455-506-494
 AtREG425ATAAGGCC      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG351 TAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG429   AGGCCCGT   PPDB MotifACGGGC  PLACE MotifGGGCC 
 AtREG401    GGCCCGTT  PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE MotifGGGCC 
 AtREG399     GCCCGTTA PPDB MotifACGGGC  PLACE MotifYAACKG, CNGTTR 
REGCGCCGTTTTGA+35825543582564-395-385
 AtREG524CGCCGTTT    PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG531 GCCGTTTT   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG653   CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.