version
PlantPromoterDB promoter information of AT5G11280.1

Summary of Gene (AT5G11280.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G11280  TAIR      NCBI 
Gene model AT5G11280.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80200.1); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 3596321-3597520)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G11280.1                      5'->3' (+)
Promoter sequence












 
AT5G11270.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G11280.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA15+3597257-64

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+3597257-64
TSS cloneAclone+3597258-63
TSS cloneCclone+3597259-62
TSS cloneTclone+3597297-24
TSS cloneCclone+3597310-11

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTTATAAAG+35972153597223-106-98
Y PatchCATCTCTCTCTCTCTCTCT+35972753597293-46-28
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAACGACG+35970133597021-308-300
 AtREG520AAAACGAC  PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG PPDB Motif  PLACE Motif 
REGACGACGCC+35970393597046-282-275
 AtREG537ACGACGCC PPDB Motif  PLACE Motif 
REGGGCTTTTA+35970653597072-256-249
 AtREG549GGCTTTTA PPDB Motif  PLACE Motif 
REGTAAACGACGTCGTTTA+35971403597155-181-166
 AtREG415 AAACGACGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG493  AACGACGTCGTT   PPDB MotifACGT  PLACE MotifACGT 
 AtREG431   ACGACGTCGT    PPDB MotifACGT  PLACE MotifACGT 
 AtREG565TAAACGACGTCGTTTA PPDB Motif  PLACE Motif 
REGCGTGTCGTT+35972083597216-113-105
 AtREG428CGTGTCGT ABA, DREB1Aox, Ethylene, Drought PPDB Motif  PLACE Motif 
 AtREG527 GTGTCGTTDREB1Aox PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG2-3597099AT5G11270.1
TSS peakA2-3597083AT5G11270.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneCclone-3597098AT5G11270.1
TSS cloneAclone-3597095AT5G11270.1
TSS cloneAclone-3597083AT5G11270.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxCATATAAAAA-35971223597131AT5G11270.1
Y PatchCGTCTCTC-35970343597041AT5G11270.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAAACGACGTCGTTTA-35971403597155AT5G11270.1
 AtREG415 AAACGACGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG493  AACGACGTCGTT   PPDB MotifACGT  PLACE MotifACGT 
 AtREG431   ACGACGTCGT    PPDB MotifACGT  PLACE MotifACGT 
 AtREG565TAAACGACGTCGTTTA PPDB Motif  PLACE Motif 
REGTAAACGACACG-35972083597218AT5G11270.1
 AtREG565TAAACGAC    PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA   PPDB Motif  PLACE Motif 
 AtREG527  AACGACAC DREB1Aox PPDB Motif  PLACE Motif 
 AtREG428   ACGACACGABA, DREB1Aox, Ethylene, Drought PPDB Motif  PLACE Motif 
REGAACGACGA-35972393597246AT5G11270.1
 AtREG648AACGACGA PPDB Motif  PLACE Motif 
REGGTAAACCGA-35973783597386AT5G11270.1
 AtREG519GTAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.