version
PlantPromoterDB promoter information of AT5G11440.1

Summary of Gene (AT5G11440.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G11440  TAIR      NCBI 
Gene model AT5G11440.1  
Description Interacts with PAB (poly A binding protein) in yeast two hybrid experiments. Contains PAM2 motif, a PABC interacting domain.  
#
#

Overview

Focused view (chromosome 5: 3654607-3653408)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G11440.1                      5'->3' (-)
Promoter sequence







 
AT5G11450.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G11440.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5-3654062-455

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTTCTTC-36540163654024-409-417
Y PatchTTCCTTCT-36540513654058-444-451
Y PatchTTTCTTCTTCTCCT-36540943654107-487-500
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATAACCGGGT-36543043654313-697-706
 AtREG548ATAACCGG   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG455  AACCGGGT PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCGGTTAAA-36543213654329-714-722
 AtREG501CCGGTTAA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG645 CGGTTAAA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG8+3654419AT5G11450.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+3654430AT5G11450.1
TSS cloneAclone+3654443AT5G11450.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACCCGGTTAT+36543043654313AT5G11450.1
 AtREG455ACCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG548  CCGGTTAT PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGTTTAACCGG+36543213654329AT5G11450.1
 AtREG645TTTAACCG  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501 TTAACCGG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGTTCGGTTTAATAAACCGA+36543573654374AT5G11450.1
 AtREG568TTCGGTTT           PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473  CGGTTTAA         PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG598         ATAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TCGGTTTA TAAACCGA PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.