version
PlantPromoterDB promoter information of AT5G13840.1

Summary of Gene (AT5G13840.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G13840  TAIR      NCBI 
Gene model AT5G13840.1  
Description FIZZY-RELATED 3 (FZR3); FUNCTIONS IN: signal transducer activity; INVOLVED IN: signal transduction; LOCATED IN: chloroplast, heterotrimeric G-protein complex; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: FZR2 (FIZZY-RELATED 2); signal transducer (TAIR:AT4G22910.1); Has 36052 Blast hits to 18440 proteins in 539 species: Archae - 52; Bacteria - 4990; Metazoa - 16346; Fungi - 7057; Plants - 2837; Viruses - 0; Other Eukaryotes - 4770 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 4471706-4470507)

Genome position     
from initiation codon
AT5G13845.1         
TSS from cDNA
TSS information
AT5G13840.1                      5'->3' (-)
Promoter sequence





 
AT5G13845           
AT5G13845.1         
AT5G13850.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G13840.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG5-4470845-139

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-4470991-285

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxATTATATAAT-44708704470879-164-173
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACCGTTGGA-44709564470965-250-259
 AtREG553GACCGTTG  Auxin PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
 AtREG554  CCGTTGGA PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
REGGCCACGTGGTTAAAAGCCACGCGCT-44710694471093-363-387
 AtREG367GCCACGTG                 ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG544  CACGTGGT               ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG549          TAAAAGCC        PPDB Motif  PLACE Motif 
 AtREG608             AAGCCACG    ABA PPDB Motif  PLACE MotifGCCAC 
 AtREG381                 CACGCGCT PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA17+4471319AT5G13850.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+4471299AT5G13850.1
TSS cloneTclone+4471300AT5G13850.1
TSS cloneTclone+4471305AT5G13850.1
TSS cloneCclone+4471350AT5G13850.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCTCTCTCT+44713424471353AT5G13850.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAGCGCGTGGCTTTTAACCACGTGGC+44710694471093AT5G13850.1
 AtREG381AGCGCGTG                  PPDB MotifACGCGC  PLACE Motif 
 AtREG608    CGTGGCTT             ABA PPDB Motif  PLACE MotifGCCAC 
 AtREG549       GGCTTTTA           PPDB Motif  PLACE Motif 
 AtREG544               ACCACGTG  ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG367                 CACGTGGCABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
REGACCGGTTTGG+44711634471172AT5G13850.1
 AtREG436ACCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496 CCGGTTTG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550  CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGAACCCGAC+44712254471232AT5G13850.1
 AtREG580AACCCGAC PPDB MotifCCGAC  PLACE MotifCCGAC 
REGTCAAAACG+44712474471254AT5G13850.1
 AtREG653TCAAAACG PPDB MotifAAACG(C/G)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.