version
PlantPromoterDB promoter information of AT5G14040

Summary of Gene (AT5G14040)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G14040  TAIR      NCBI 
Gene model AT5G14040  
Description mitochondrial phosphate transporter; FUNCTIONS IN: binding; INVOLVED IN: transport; LOCATED IN: in 7 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial phosphate transporter, putative (TAIR:AT3G48850.1); Has 12348 Blast hits to 8451 proteins in 336 species: Archae - 0; Bacteria - 0; Metazoa - 6294; Fungi - 3202; Plants - 1869; Viruses - 3; Other Eukaryotes - 980 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 4533965-4532766)

Genome position     
from initiation codon
AT5G14040.1         
TSS from cDNA
TSS information
AT5G14040                        5'->3' (-)
Promoter sequence










 
AT5G14050.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence










 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G14040

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA254-4533070-105

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-4533070-105
TSS cloneTclone-4533069-104
TSS cloneTclone-4533068-103
TSS cloneGclone-4533067-102
TSS cloneGclone-4533066-101
TSS cloneTclone-4533065-100
TSS cloneAclone-4533049-84
TSS cloneAclone-4533047-82
TSS cloneAclone-4533041-76
TSS cloneTclone-4532994-29

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTAATTA-45331444533151-179-186
 AtREG646CGTAATTAABA PPDB Motif  PLACE Motif 
REGAAAAAGCCCATGGGCCAA-45331784533195-213-230
 AtREG589AAAAAGCC           PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC          PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT        PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG591      CCCATGGG     PPDB MotifGCCCA, CCATGG  PLACE Motif 
 AtREG507     GCCCATGGGC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 AtREG504        CATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE MotifGGGCC, TGGGCY 
 AtREG490         ATGGGCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484          TGGGCCAA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTTAATGGG-45332184533225-253-260
 AtREG396TTAATGGG PPDB MotifGCCCA  PLACE MotifTTAATGG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+4533273AT5G14050.1
TSS clone peakAclone+4533291AT5G14050.1
TSS cloneTclone+4533297AT5G14050.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGGCTTTATTGGGC+45330934533106AT5G14050.1
 AtREG365GGGCTTTA       PPDB MotifGCCCA  PLACE Motif 
 AtREG601 GGCTTTAT      PPDB Motif  PLACE Motif 
 AtREG417     TTATTGGG  PPDB MotifGCCCA  PLACE Motif 
 AtREG355      TATTGGGC PPDB MotifGCCCA  PLACE Motif 
REGTAATTACG+45331444533151AT5G14050.1
 AtREG646TAATTACGABA PPDB Motif  PLACE Motif 
REGTTGGCCCATGGGCTTTTT+45331784533195AT5G14050.1
 AtREG484TTGGCCCA           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490 TGGCCCAT          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG504  GGCCCATG         PPDB MotifGCCCA, CCATGG  PLACE MotifGGGCC, TGGGCY 
 AtREG591    CCCATGGG       PPDB MotifGCCCA, CCATGG  PLACE Motif 
 AtREG507   GCCCATGGGC      PPDB MotifGCCCA, CCATGG  PLACE Motif 
 AtREG378       ATGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376        TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409         GGGCTTTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG589          GGCTTTTT PPDB Motif  PLACE Motif 
REGCCCATTAA+45332184533225AT5G14050.1
 AtREG396CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.