version
PlantPromoterDB promoter information of AT5G14120

Summary of Gene (AT5G14120)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G14120  TAIR      NCBI 
Gene model AT5G14120  
Description nodulin family protein; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nodulin-like (InterPro:IPR010658), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: nodulin family protein (TAIR:AT3G01930.2); Has 1558 Blast hits to 1511 proteins in 424 species: Archae - 7; Bacteria - 707; Metazoa - 14; Fungi - 166; Plants - 321; Viruses - 0; Other Eukaryotes - 343 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 4551208-4552407)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G14120                        5'->3' (+)
Promoter sequence

 
AT5G14100.1         
AT5G14105.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence












 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G14120

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8+4555845-463
TSS peakA51+4556163-145

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+4555840-468
TSS cloneAclone+4556159-149
TSS cloneGclone+4556160-148
TSS cloneTclone+4556230-78
TSS cloneAclone+4556237-71
TSS cloneTclone+4556254-54

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTTCT+45561994556207-109-101
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTCCACGT+45555684555575-740-733
 AtREG627TTCCACGT PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGCGTAATTA+45560224556029-286-279
 AtREG646CGTAATTAABA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4-4551772AT5G14100.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-4551732AT5G14100.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAAAGCCCAATTAAGGCCCATTC-45518294551851AT5G14100.1
 AtREG409AAAAGCCC                PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402   AGCCCAAT             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG418    GCCCAATT            PPDB MotifGCCCA  PLACE Motif 
 AtREG600     CCCAATTA           PPDB MotifGCCCA  PLACE Motif 
 AtREG416          TTAAGGCC      PPDB Motif  PLACE Motif 
 AtREG351           TAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353            AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354             AGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361              GGCCCATT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG643               GCCCATTC PPDB MotifGCCCA  PLACE Motif 
REGCCGTTAAA-45518714551878AT5G14100.1
 AtREG610CCGTTAAA PPDB Motif  PLACE MotifYAACKG, CNGTTR 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.