version
PlantPromoterDB promoter information of AT5G14200.1

Summary of Gene (AT5G14200.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G14200  TAIR      NCBI 
Gene model AT5G14200.1  
Description The AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids.  
#
#

Overview

Focused view (chromosome 5: 4575220-4576419)

Genome position     
from initiation codon
AT5G14200.2         
AT5G14200.3         
TSS from cDNA
TSS information
AT5G14200.1                      5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G14200.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG85+4576203-17

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+4576204-16
TSS cloneAclone+4576206-14
TSS cloneAclone+4576207-13

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTATATAAC+45761714576179-49-41
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGATGGGCTA+45759384575947-282-273
 AtREG635TGATGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG581  ATGGGCTA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCGGCCCAATAT+45759544575964-266-256
 AtREG414CGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352 GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355  GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG509   CCCAATAT PPDB Motif  PLACE Motif 
REGAAATGGGCCAAT+45759754575986-245-234
 AtREG386AAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG361 AATGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490  ATGGGCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484   TGGGCCAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG446    GGGCCAATCK PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTAAAGGCCCAATTA+45759934576006-227-214
 AtREG467TAAAGGCC       PPDB Motif  PLACE Motif 
 AtREG359 AAAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352    GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG418     GCCCAATT  PPDB MotifGCCCA  PLACE Motif 
 AtREG600      CCCAATTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.