version
PlantPromoterDB promoter information of AT5G14240.1

Summary of Gene (AT5G14240.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G14240  TAIR      NCBI 
Gene model AT5G14240.1  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Phosducin (InterPro:IPR001200), Thioredoxin-like fold (InterPro:IPR012336); Has 750 Blast hits to 750 proteins in 282 species: Archae - 0; Bacteria - 2; Metazoa - 486; Fungi - 126; Plants - 51; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 4598568-4597369)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G14240.1                      5'->3' (-)
Promoter sequence


 
AT5G14250.1         
AT5G14250.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G14240.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG13-4597660-92

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-4597660-92
TSS cloneTclone-4597656-88
TSS cloneCclone-4597653-85

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCCTCT-45976154597623-47-55
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCGGTTTAG-45977144597722-146-154
 AtREG514TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG511 CGGTTTAG PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCGGTTCG-45977444597751-176-183
 AtREG423CCGGTTCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGGGCTTTTA-45977644597771-196-203
 AtREG549GGCTTTTA PPDB Motif  PLACE Motif 
REGCGGTTAAG-45978144597821-246-253
 AtREG605CGGTTAAG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA8+4597876AT5G14250.1, AT5G14250.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxGTATATATATT+45978344597844AT5G14250.1, AT5G14250.2
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAAAGGCC+45976874597694AT5G14250.1, AT5G14250.2
 AtREG459AAAAGGCC PPDB Motif  PLACE Motif 
REGCTAAACCGA+45977144597722AT5G14250.1, AT5G14250.2
 AtREG511CTAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCGAACCGG+45977444597751AT5G14250.1, AT5G14250.2
 AtREG423CGAACCGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGTAAAAGCC+45977644597771AT5G14250.1, AT5G14250.2
 AtREG549TAAAAGCC PPDB Motif  PLACE Motif 
REGCTTAACCG+45978144597821AT5G14250.1, AT5G14250.2
 AtREG605CTTAACCG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.