version
PlantPromoterDB promoter information of AT5G14580

Summary of Gene (AT5G14580)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G14580  TAIR      NCBI 
Gene model AT5G14580  
Description polyribonucleotide nucleotidyltransferase, putative; FUNCTIONS IN: polyribonucleotide nucleotidyltransferase activity, 3'-5'-exoribonuclease activity, RNA binding, nucleic acid binding; INVOLVED IN: mRNA catabolic process, RNA processing; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), K Homology, type 1, subgroup (InterPro:IPR018111), Exoribonuclease, phosphorolytic domain 2 (InterPro:IPR015847), S1, RNA binding (InterPro:IPR003029), Polynucleotide phosphorylase, phosphorolytic RNA-binding, bacterial/organelle-type (InterPro:IPR015848), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), K Homology (InterPro:IPR004087), Exoribonuclease, phosphorolytic domain 1 (InterPro:IPR001247), Polyribonucleotide nucleotidyltransferase (InterPro:IPR012162); BEST Arabidopsis thaliana protein match is: RIF10 (resistant to inhibition with FSM 10); 3'-5'-exoribonuclease/ RNA binding / nucleic acid binding / polyribonucleotide nucleotidyltransferase (TAIR:AT3G03710.1); Has 19856 Blast hits to 18048 proteins in 1642 species: Archae - 206; Bacteria - 10090; Metazoa - 440; Fungi - 100; Plants - 266; Viruses - 0; Other Eukaryotes - 8754 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 4711363-4710164)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G14580                        5'->3' (-)
Promoter sequence

 
AT5G14610.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G14580

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2-4703615-602

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCAAACCG-47037064703713-693-700
 AtREG550CCAAACCG PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG2+4710566AT5G14610.1
TSS peakG2+4710621AT5G14610.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+4710572AT5G14610.1
TSS cloneCclone+4710575AT5G14610.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTCTTT+47106074710617AT5G14610.1
Y PatchCCTCTTCTCTCT+47106274710638AT5G14610.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCATGGGCCCAAAT+47104584710470AT5G14610.1
 AtREG504CATGGGCC      PPDB MotifGCCCA, CCATGG  PLACE MotifGGGCC, TGGGCY 
 AtREG391 ATGGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422  TGGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392   GGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373    GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG421     GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGTAAGCCCAATAAG+47104994710511AT5G14610.1
 AtREG426TAAGCCCA      PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402  AGCCCAAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355   GCCCAATA   PPDB MotifGCCCA  PLACE Motif 
 AtREG417    CCCAATAA  PPDB MotifGCCCA  PLACE Motif 
 AtREG611     CCAATAAG PPDB Motif  PLACE Motif 
REGCGAACCGGC+47105654710573AT5G14610.1
 AtREG423CGAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG637 GAACCGGC PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.